Sentence examples for evaluated the brains from inspiring English sources

We initially evaluated the brains of 3-week old sod2 null animals treated with low and high doses of the catalytic antioxidant, EUK-189.

We then evaluated the brains of WT, heterozygous, and Ppt1-KI littermates for GRODs by transmission electron microscopy.

We evaluated the brains of diTDP-43WT mice for the presence of ubiquitin- and TDP-43-positive inclusions observed in human TDP-43 proteinopathies.

The sequences for the primers (5' to 3') used are as follows: Amfor -F: AATATAACTTCCGGTGCAACGTATT; Amfor -R: CGTTTGGATCACGGAAGAAAG; eIFS8-F: TGAGTGTCTGCTATGGATTGCAA; eIFS8-R: TCGCGGCTCGTGGTAAA; We evaluated the brain gene-expression levels of 9 SDI queens and 9 MDI queens (derived from two cohorts).

To measure brain edema, we evaluated the brain water content at 48 h after i.p. treatment.

We evaluated the brain injury after HCA with the light microscopy and electron microscopy.

We evaluated the brain cancer killing potential of these nanoparticles, their potential off-target cytotoxicity to noncancer human primary cells, and the potential for the nanoparticles to effectively target siRNA delivery to brain cancer cells over healthy brain cells.

In the current study, the researchers used MRI to evaluate the brains of 40 New York City children, ages 5 to 11, whose mothers were enrolled prenatally in a larger cohort study.

His research employs a combination of molecular and cellular biology, behavioral experiments, and in vivo electrophysiology to evaluate the brains of mice that are able to move about freely, which will produce results more akin to those found in normal conditions.

Human neuroimaging is used to evaluate the brain's response to these processes and determine whether brain measures provide sensitive markers for these addictive processes.

The second objective of this study was to evaluate the brain basis of individual differences in creative conceptual expansion.