Sentence examples for evaluated the brain from inspiring English sources

The sequences for the primers (5' to 3') used are as follows: Amfor -F: AATATAACTTCCGGTGCAACGTATT; Amfor -R: CGTTTGGATCACGGAAGAAAG; eIFS8-F: TGAGTGTCTGCTATGGATTGCAA; eIFS8-R: TCGCGGCTCGTGGTAAA; We evaluated the brain gene-expression levels of 9 SDI queens and 9 MDI queens (derived from two cohorts).

We evaluated the brain injury after HCA with the light microscopy and electron microscopy.

To measure brain edema, we evaluated the brain water content at 48 h after i.p. treatment.

We evaluated the brain cancer killing potential of these nanoparticles, their potential off-target cytotoxicity to noncancer human primary cells, and the potential for the nanoparticles to effectively target siRNA delivery to brain cancer cells over healthy brain cells.

We initially evaluated the brains of 3-week old sod2 null animals treated with low and high doses of the catalytic antioxidant, EUK-189.

We then evaluated the brains of WT, heterozygous, and Ppt1-KI littermates for GRODs by transmission electron microscopy.

We evaluated the brains of diTDP-43WT mice for the presence of ubiquitin- and TDP-43-positive inclusions observed in human TDP-43 proteinopathies.

Human neuroimaging is used to evaluate the brain's response to these processes and determine whether brain measures provide sensitive markers for these addictive processes.

The second objective of this study was to evaluate the brain basis of individual differences in creative conceptual expansion.

To evaluate the brain venous circulation in fetuses with severe intrauterine growth restriction (IUGR) before 32 weeks of gestation.

The present functional magnetic resonance images study is aimed at evaluating the brain correlates of cue-induced gaming urge or smoking craving in subjects with both IGA and nicotine dependence to make a simultaneous comparison of cue induced brain reactivity for gaming and smoking.