Sentence examples for evaluate the brain from inspiring English sources
To evaluate the brain venous circulation in fetuses with severe intrauterine growth restriction (IUGR) before 32 weeks of gestation.
The second objective of this study was to evaluate the brain basis of individual differences in creative conceptual expansion.
Third, this study is the first to evaluate the brain structural changes in ETTH; further studies would benefit from integrating both structural and functional networks associated with the pathophysiological underpinnings of ETTH.
The Lf ELISA results confirmed the biorecognitive activity of Lf after the coupling procedure and suggested the average number of Lf conjugated on each nanoparticle was around 55. To evaluate the brain delivery properties of the Lf NP, a fluorescent probe, coumarin-6 was incorporated into it.
The ratios of Cb/Cp (brain/plasma concentration ratios), an important indicator to evaluate the brain uptake index [10], [25], were used to further evaluate BBB penetration of honokiol.
Magnetic resonance imaging (MRI) and immunohistological analyses were performed to evaluate the brain for demyelination.
The present functional magnetic resonance images study is aimed at evaluating the brain correlates of cue-induced gaming urge or smoking craving in subjects with both IGA and nicotine dependence to make a simultaneous comparison of cue induced brain reactivity for gaming and smoking.
The sequences for the primers (5' to 3') used are as follows: Amfor -F: AATATAACTTCCGGTGCAACGTATT; Amfor -R: CGTTTGGATCACGGAAGAAAG; eIFS8-F: TGAGTGTCTGCTATGGATTGCAA; eIFS8-R: TCGCGGCTCGTGGTAAA; We evaluated the brain gene-expression levels of 9 SDI queens and 9 MDI queens (derived from two cohorts).
To measure brain edema, we evaluated the brain water content at 48 h after i.p. treatment.
We evaluated the brain injury after HCA with the light microscopy and electron microscopy.
In this respect, evaluating the brain functional antidepressant effects will allow a better understanding of the pathogenesis of MDD and its response to antidepressant treatment.
