Sentence examples for estimated and compared using from inspiring English sources

Exact(15)

Total allelopathic potential of four winter wheat accessions from the Loess Plateau was estimated and compared using a systems theory approach.

Treatment costs and cost effectiveness of a hollow-fiber nanofiltration (HFNF) system vs. an integrated system comprised of spiral-wound nanofiltration (SWNF) pre-treated with hollow-fiber ultrafiltration (HFUF) are estimated and compared using numerical simulation and cost modeling.

Using this philosophy, the stress states and failure lives of pipe bends of the same type (i.e. Hot Reheat or Main Steam) with similar, but not identical, dimensions may be estimated and compared using approximations of the peak rupture stress function.

The prognostic factors were estimated and compared using survival curves, the area under the prognostic ROC curves and multivariate analysis.

Haplotype frequencies were estimated and compared using the haplo.score module of the haplo.stats package (http://cran.r-project.org/web/packages/haplo.stats/index.html).html

A set of two models were estimated and compared using Confirmatory Factor Analysis; 1) a one factor solution with all items loading on one disability factor as indicated in the PCA; 2) A theoretical hierarchical solution that included a single second-order factor representing disability, and six first-order factors that represent the six domains of disability.

Show more...

Similar(45)

Kaplan Meier curves were used to estimate survival, and compared using the log-rank test.

Survival curves were derived from Kaplan Meier estimates and compared using log-rank tests.

Survival curves were plotted according to the Kaplan Meier estimate and compared using the long-rank test.

Rates were derived for each PCT (n=25) using yearly population data constrained to 2001 local authority mid-year estimates, and compared using the χ test for heterogeneity.

RARRES3 short hairpins sequence: sh#1: CCGGCCCGCTGTAAACAGGTGGAAACTCGAGTTTCCACCTGTTTACAGCGGGTTTTTG sh#2: CCGGGCGCTTGGAATCCTGGTTGTTCTCGAGAACAACCAGGATTCCAAGCGCTTTTTG Control short hairpin: ShControl: CCGGCATCGACAAGACTGCTAACCACTCGAGTGGTTAGCAGTCTTGTCGATGTTTTTG Metastasis-free survival curves of mice were plotted using Kaplan Meier estimates and compared using the log-rank test.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: