Sentence examples similar to er rev from inspiring English sources

P. A. Stephenson: Perhaps they move Santa about during day before Christ's remembered, with hearts lifted all round (REINDEER/REDEEMER; REINDEREEMER; r in d ere; reme mb ered (rev).).

(Shylock speaks of those who, at the irritating sound of the bagpipe, "cannot contain their urine". Just those four syllables — Rev-er-end-Wright — affect me similarly.

The Rt Rev Tom Wright, the Bishop of, er, Durham, says that under Labour: "While the rich have got richer, the poor have got poorer".

A PCR product containing 5X UAS, m35S and an ER signal was made using the oligonucleotide primers UASCP7F1 (5'TAT GGTACCGATTACGCCAAGCTTGCATG) and 5XUAS/ER-REV ('TTGG CCATGGAACAGGTAGTTT) with pBinMGal4-VP16+UASmgfp5-ER pBinMGal4-VP16+UASmgfp5-ER pBinMGal4-VP16+UASmgfp5-ER, see website [ 33] as the template. kindlynd NcoI sites are in bold.

(rein er flap (all rev .. P. D. Gaffey: With a 'hoss' one might be a plier of harness (comp. anag. & lit).. J. Grimes: Unveiling life partner could make this groom tense (anag. incl. t).

(The Rev).

(Most Rev).

Er, quite.

Er, sorry.

Er … sure.

Er, Solihull".