Sentence examples for equivalent pools from inspiring English sources

Exact(2)

Equivalent pools were created for the untreated (total) RNA samples.

Two cDNA libraries were constructed from the equivalent pools of time points after blood feeding in L. longipalpis midgut tissue from sand flies which had ingested amastigote-infected macrophages in an artificial blood meal (BFi and PBMDi), a more natural presentation of parasites to the blood-feeding sand fly.

Similar(58)

Further, for an equivalent pool-based experiment using Affymetrix arrays in place of Illumina arrays, more array replicates will be needed (~10-fold more).

As a control for equivalent starting pools of cDNA, the primers Actin forward GTTCTCTCCTTGTATGCAAGTG and Actin reverse CCAGACTCATCATATTCACCTTTAG were used to amplify a 700 bp segment of soybean actin gene cDNA (emb|V00450.1|) The RT-PCR was performed in triplicate at 55°C, testing three different numbers of cycles (30-35-40) to conon-saturationratiof of amplification.

In order to improve the clinical relevance of conventional cardiovascular risk factors, we translated some of the most robust into age equivalents and used their combined average to compute CardioMetablic Age (CMA), the age equivalent of pooled cardiovascular risk.

Using a threshold of -K on the final formula (minimum of the ranks) is equivalent to pooling the top K hits, and removing redundant hits, from each single-molecule query.

For example, a conventional ChIP assay requires a large amount of chromatin which is equivalent to pooled gonads of five to six hundred embryos [6], [18].

A 50 mL volumetric equivalent of pooled tissue for each of the eight gorgonian species was extracted twice at room temperature in 250 mL reagent grade acetone overnight with agitation.

Data from males and females were equivalent and pooled.

This is physically equivalent to pooling together all accessible conformational sub-states defined at each energy level.

This is equivalent to pooling findings from the active treatment arms of RCTs and comparing these estimates, an approach which is considered not to be appropriate for the meta-analysis of RCTs [ 12].

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: