Sentence examples for enrichment efficiency from inspiring English sources

Exact(59)

The eluted portion after removing non-hybridized DNA was highly enriched for microsatellites, with enrichment efficiency between 50 90% [ 13].

However very low enrichment efficiency (10%to3131%) were obtained in some other libraries enriched for SSRs [ 8, 9, 21].

For the purpose of enrichment efficiency, we compared the 6 matched samples, where were independently enriched, as described in methods, and sequenced on SOLiD 3.0 platform octet slides (18 octets "spots" in total).

The enriched proteomes are visualized by igFl to assess metabolic tagging and enrichment efficiency, or analyzed through on-bead proteolytic digestion, MS analysis, and software-aided protein identification.

We developed a new method for mutant-enrich PCR only with snapback primer (SPACE-PCR), in which the enrichment efficiency is nearly 100-fold.

First, the size and concentration was checked on the Agilent 2100 Bioanalyzer and in a second step the enrichment efficiency was estimated by qPCR (Applied Biosystems) using a primerset for an enriched exon (fw: ATCCCGGTTGTTCTTCTGTG and rv: TTCTGGCTCTGCTGTAGGAAG) and a primerset in an intron region as a negative control (fw: AGGTTTGCTGAGGAACCTTGA and rv: ACCGAAACATCCTGGCTACAG).

The enrichment efficiency of the monolithic columns was tested by using phthalates as the analytes.

The results showed that the enrichment efficiency varied as the flow factors changed.

However, in order to achieve higher enrichment efficiency of target analytes, the choice of suitable sorbents for SPE is extremely important (Adeyemi et al. 2011).

Zhou reported that graphene-modified TiO2 nanotube arrays exhibit an excellent enrichment efficiency for carbamate pesticides including metolcarb, carbaryl, isoprocarb, and diethofencarb.

We investigated the enrichment efficiency of bare silica and poly ethylene glycol) methacrylate (PEGMA -functionalized silica nanoPEGMA -functionalizedqueousilicationanoparticles

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: