Sentence examples for enrich samples from inspiring English sources

The TruSeq stranded mRNA sample preparation kit (Illumina) was used to enrich samples for mRNA and construct libraries for sequencing.

The selective lysis of cells, either to enrich samples for diagnostic assays or to target drug delivery and enhance therapy, is of considerable interest.

Frozen plasma (CON, n = 4; LMN, n = 4) was depleted of albumin and IgG using human-specific affinity chromatography columns (Seppro, Sigma-Aldrich, St . Louis MO) to enrich samples for low-abundance proteins.

Finally, the amplification portion of the assay also has clear application as a straight-forward method to enrich samples for mtDNA for next-generation sequencing studies in any discipline.

It is a powerful method to enrich samples for differentially expressed transcripts by combining steps of suppression and normalization prior to differential screening, and this starting from very little material.

A 12 cycles cDNA amplification was performed to selectively enrich samples of fragments with both adapters ligated, using Phusion DNA Polymerase (Finnzymes Oy, Finland) with the primer combination GX1 (CAAGCAGAAGACGGCATACGA), GX2 (AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) according to Illumina protocol.

Plasma water deuterium enriched samples were diluted 6 times to reduce the level of enrichment to working levels.

Enriched samples that amplified at least 10 cycles earlier than unenriched samples (>1000-fold >1000-fold assuming 100% primenrichmentncy) were considered successful.

Then, extraction was continued following the same procedure applied to protists- and metazoans- enriched samples, including the additional post-extraction DNase treatment, already described in Section 2.1.

It was shown that gas-phase oxidation, as compared with centrifugation, weakly (by 5%) enriches samples (in which more than 60% of SWNTs were burned) by SWNTs with large diameters.

The bioassay battery used enriched samples and measured mode-of-action specific toxicity.