Sentence examples similar to engineered 1 from inspiring English sources

Stably transfected CHO-K1 cells that individually report (luciferase) on the PERK/eIF2α/ATF4/CHOP (apoptotic) or the IRE1/XBP1 (adaptive) UPR pathways, were engineered [1].

We report the 1.77-Å resolution X-ray crystal structure of a dodecamer DNA duplex with the sequence 5′-CCTCTGGTCTCC-3′ that has been modified to contain a single engineered 1,2-cis-{Pt(NH3 2}2+-d(GpG) cross-liNH3 2}2+-djor DNA adduct of cisplatin.

We have compared several engineered S6K enzymes.

Concrete Frame/Reinforced Masonry, engineered 1 3 storey building with a Low roof pitch <6°.

Fig. 7 Estimates of building vulnerability for C3RML-ENG Concrete Frame/Reinforced Masonry, engineered 1 3 storey building with a Low roof pitch <6° recorded for eight experts who took part in the GAR15 workshop.

Damage index refers to the replacement cost of the structure Fig. 5 Vulnerability functions estimated independently by four 'experts' for C3RML-ENG Concrete Frame/Reinforced Masonry, engineered 1 3 storey building with a Low roof pitch <6°.

Soliris® (Eculizumab) Alexion Pharma 03/16/07 C5 PNH Humanized hybrid engineered IgG2/4 Mouse hybridoma 25.

We then generated ATG5 overexpressing MCF10A cell line using this engineered ATG5 overexpression cassette.

A decoy is a supposedly inactive, computationally engineered [19] or randomly chosen [8] molecule.

Proteins are usually composed of the 20 naturally occurring amino acids, but variants composed of reduced-size amino acid alphabets have been engineered [1], and the genetic code has been expanded by addition of unnatural amino acids [2], [3].

The reverse primer contained an engineered EcoR1 site (bold): 5'CGCGCGAATTCCTATTCCACCACTAAAACATTGTT3'.