Sentence examples for ends of the backbone from inspiring English sources

Suggestions(1)

Exact(1)

The K28A mutation increases the intrapeptide hydrophobic interactions that promote population of structures in Basin I and Basin II whose structures are characterized by hydrophobic interaction between V24 and K28 side chains but with well-separated ends of the backbone atoms in the VGSN turn.

Similar(58)

Coccyx, also called tailbone, curved, semiflexible lower end of the backbone (vertebral column) in apes and humans, representing a vestigial tail.

The Manx may be born with a tail but ideally should be totally tailless with a hollow at the end of the backbone where the root of the tail should be.

The leak was coming from the station's port side, at the far end of the backbone, or truss, structure that holds one of the laboratory's huge sets of solar arrays.

The establishment of Will Rogers State Historic Park opens the Inspiration Point Loop Trail, which would become the eastern end of the Backbone Trail.

Copolymer based on acrylic acid derivatives containing mesogenic groups in the side chains and thiol group at the end of the backbones has been synthesized to create a liquid crystal cholesteric composite with the gold nanoparticles (NPs).

Two types of PHPS, with and without methyl (–CH3) groups at the ends of the silicon nitrogen backbone were used, and the amorphous silica membrane derived from the PHPS having –CH3 end groups was found to exhibit higher hydrogen permeance and hydrogen/nitrogen perm-selectivity compared to those of the membrane derived from the end group-free PHPS.

The pColE2 backbone was amplified using primers 5' – AAGGATCCTATTTTTTTCATAACGACTCCTTGTTGTG – 3' and 5' – AATCTAGACCCGAAATCCTCTTTGACAAAAACAAAGC – 3', which introduced a BamHI and an XbaI site to the 5' and 3' ends of the plasmid backbone, respectively.

Endo- β-1,4-xylanases cleave the backbone of xylan (i.e., the β-1,4 d-xylose chain) in the middle, generating substrates for the β-xylosidase which cleaves off d-xylose from the non-reducing ends of the xylan backbone.

Given these properties and the absence of various glycerol-derived phospholipids, such as cardiolipin and phosphatidylethanolamine, in T. roseum, it is probable that carotenoids modified by glycosylation and acylation at both ends of the C-40 backbone play an important role in membrane stabilization in this thermophile (Figure 4C).

New telechelic cis-1,4-polyisoprene oligomers bearing an hydroxyl group at the end of the polyisoprene backbone and possessing controlled molecular weights were used as soft segments in the elaboration of polyurethane elastomers.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: