Sentence examples for ends forward from inspiring English sources

The PH-PKB-mCherry sequence was amplified by PCR using primers to incorporate Xba1 and Sma1 sites at the 5' and 3' ends (forward: 5'-AAAATCTAGAATGAACGACGTAGCCATTGTGAA; reverse 5'-TGAATTCCCGGGTTACTTGTAGAGCTCGTCCATGC).

The genomic segment spanning exon 71 to exon 73 of human DMD was amplified by PCR using NEB Phusion polymerase and 200 ng male genomic DNA as template (Promega), generating a 5.6 kb product with NcoI restriction sites at both ends (forward: 5'TTGCandATGGTTACTCTGATCAACTTCTG3' and reverse: 5'GGATACCATGGTGCTCTCATTAGGAGAGATG3').

Of these BACs, 5,058 were sequenced at both ends (forward and reverse directions), and 916 (unpaired BACs) were sequenced in only one direction (512 forward and 404 reverse).

Loop the ends forward and tie them on top to make a turban.

Bring the ends forward and twist them around each other once at your forehead.

Bring the free ends forward once again, this time around your waist, and tie a square knot.

"They played like they weren't ready for their season to end," forward Gerald Wallace said.

Open-ended forward genetic screens remain one of the most powerful genetic approaches to identify critical, and often unexpected, regulators of biological processes.

Loan ended: Lee Erwin, forward (Motherwell); Leighton McIntosh, forward (Dundee); Paul McManus, forward (Forfar Athletic); Steven Doris, forward (Dundee).

The show ends pointing forward, with works by William Glackens, John Sloan and the great Maurice Brazil Prendergast.

Loan ended: Lawrence Shankland, forward (Aberdeen); Jordan Moore, forward (Dundee United).