Sentence examples for end were obtained from inspiring English sources

After two pieces of correspondence purportedly written by the former New England Patriots tight end were obtained by TMZ, it was Radar Online that came up with the third missive to be published.

With RsaI, 3 fragments of 406, 355 and 146 nts (in this order from 5' end) were obtained for B. cereus, B. anthracis, B. thuringiensis.

Chemically synthesized siRNA targeted against the intracytoplasmic loop of Cx43 (5'-GAAGTTCAAGTACGGGATT-3') [34], HiPerfect transfection reagent, nonsense sequence with no known homology to mammalian genes (AATTCTCCGAACGTGTCACGT) with rhodamine modification at the 3' end were obtained from Qiagen.

Colon tissues (3 cm from distal end) were obtained from WT mice 2 day after TNBS treatment.

For turtle, 3,461 BESs (1633 clones with both ends and 195 clones with only one end) were obtained (avg. length 703 bp, total combined length 2.4 Mb).

Next, the contigs were further connected with Trinity, and sequences that could not be extended on either end were obtained, and defined as unigenes [ 50].

Numerical results for the stress at a fixed end are obtained for frog skeletal muscle and presented in graphical form.

A piece of trim end was obtained by cutting the shortened core sample and used for contact angle measurements.

Sequencing primers were designed from flanking regions of the whole TR region and subsequently a 400-bp sequence at each end was obtained.

The RFC1 genomic sequence and 3861 bp up-stream of the 5′ end was obtained from Ensemble (ENSG00000173638), and was used for the development of the methylation assays.

Indeed, well-defined polymer supports with controlled chain-length, molecular weight distribution and fully dehalogenated chain-ends were obtained.