Sentence examples for end primer from inspiring English sources

Exact(20)

The primer used for reverse transcription is composed of 19 known nucleotides plus a downstream 30 dTs and two-anchoring nucleotides (VN, V = A, G and C, N = A, T, G and C) from 5′ to 3′ end (primer sequences, AAGCAGTGGTATCAACGCAGA GTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN).

The 5' end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGAGTTATTT), includes an additional BamHI site.

This plasmid was then used to PCR P2A-hu hnRNPC2 blunted at the 5″ end (primer 5-P2A) and with EcoRI at the 3″ end (primer 3-hu hnRNPC2-EcoRI).

In the PCR reaction, the DNA oligomer ATCGCATATGGGATCCTCTGATGTTGCCATTGTTAAAGA was used as the 5' end primer with an NdeI and BamHI restriction site and the DNA oligomer GCTAGCGGCCGCTTAGCTCGGGCTACCGCTACG as the 3' end primer with a NotI restriction site.

PCR of hu hnRNPC1 was produced with EcoRI at the 5″ end (primer 5-hu hnRNPC1-EcoRI) and blunted without the stop codon at the 3″ end (primer 3-hu hnRNPC1- -TAA)).

The ligated DNA was preamplified using EcoRI and MseI with one selective nucleotide at the 3′ end primer each.

Show more...

Similar(40)

To this end, primers with a Tm of 62°C were designed.

For the second round of amplification of the 3' end, primers internal to the first round PCR product were used.

RT-PCR amplification of the fragment was accomplished using a combination of three 5' end primers and a universal, 3' primer (Table 2) that were designed for the amplification of all known CTV sequences at the 5' end.

BAC end primers were used essentially as reported [ 25].

Assembled DNA was amplified by end primers, cloned, and sequenced.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: