Sentence examples for end primer from inspiring English sources

The primer used for reverse transcription is composed of 19 known nucleotides plus a downstream 30 dTs and two-anchoring nucleotides (VN, V = A, G and C, N = A, T, G and C) from 5′ to 3′ end (primer sequences, AAGCAGTGGTATCAACGCAGA GTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN).

The 5' end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGAGTTATTT), includes an additional BamHI site.

This plasmid was then used to PCR P2A-hu hnRNPC2 blunted at the 5″ end (primer 5-P2A) and with EcoRI at the 3″ end (primer 3-hu hnRNPC2-EcoRI).

In the PCR reaction, the DNA oligomer ATCGCATATGGGATCCTCTGATGTTGCCATTGTTAAAGA was used as the 5' end primer with an NdeI and BamHI restriction site and the DNA oligomer GCTAGCGGCCGCTTAGCTCGGGCTACCGCTACG as the 3' end primer with a NotI restriction site.

PCR of hu hnRNPC1 was produced with EcoRI at the 5″ end (primer 5-hu hnRNPC1-EcoRI) and blunted without the stop codon at the 3″ end (primer 3-hu hnRNPC1- -TAA)).

The ligated DNA was preamplified using EcoRI and MseI with one selective nucleotide at the 3′ end primer each.

To this end, primers with a Tm of 62°C were designed.

For the second round of amplification of the 3' end, primers internal to the first round PCR product were used.

RT-PCR amplification of the fragment was accomplished using a combination of three 5' end primers and a universal, 3' primer (Table 2) that were designed for the amplification of all known CTV sequences at the 5' end.

BAC end primers were used essentially as reported [ 25].

Assembled DNA was amplified by end primers, cloned, and sequenced.