Sentence examples for end partial from inspiring English sources

The governing differential equations and boundary conditions for the non-conservative instability of a Timoshenko beam subjected to an end partial tangential follower force are derived via Hamilton's principle.

Using the clustered sequences 81 full-length cDNA sequences were generated by aligning overlapping 5' and 3' end partial sequences.

To this end, partial sequences of HD1/HD2 alleles were obtained for six species and their phylogeny is shown in Figure 4.

In addition, clones representing 586 consensus sequences with both 5' and 3' end partial sequences were randomly selected and subjected to complete sequencing by single-pass primer walking, generating a further 363 full-length cDNA sequences.

Moreover, the amplification and subsequent analysis of the VP1 3′ end partial gene have been successfully used to serotype HEVs (10, 11 ) and to describe the molecular epidemiology of EV30 (12 ).

Pet issue: Ending partial birth abortion.

P4 (forward): 5′- AA CTGCAG AACAATG GCGAACAAACATTTGTCCCTCTCCCTCTTCCTCGTCCTCC (Italicized sequences indicate the Pst I site and 5′-end partial alpha amylase signal peptide sequence, respectively. The bold indicates the Kozak sequence).

In this paper, we describe the results of our analysis using 5'-end partial sequences from full-length cDNAs to systematically evaluate the current gene models for six species of apicomplexan parasites.

Using the 5'-end partial cDNA sequences corresponding to the annotated gene models, we evaluated the inconsistencies between them at three levels (a typical example is shown in Figure 1a): (1) Nucleotide-level: The total number of nucleotides either "exonic" in the cDNAs that are mis-annotated as "intronic" in the gene models or vice versa.

With IDAA1C ≤9, only 1 patient entered partial remission and 61 patients ended partial remission; with A1C ≤7.5%, 15 entered partial remission and 53 ended; with insulin dose ≤0.5 units · kg−1 · 24 h−1, 5 entered partial remission and 66 ended; and with stimulated C-peptide (>300 pmol/l), 9 entered partial remission and 49 ended.

The fact that the average value of this "in vivo" Kbair was about 10% larger than the "in vitro" value [ 32] is consistent with an end tidal partial pressure that is 10% less than the arterial partial pressure.