This analysis encompasses the following control aspects: stability; overshoot; and settling time.
The replication attempt will encompass the PBS control, the doxorubicin control and the highest dose of cimetidine (100 mg/kg).
In the control room, process control encompasses the selection and installation of panel-mounted alarms, switches, recorders, and controllers, as well as Program Logic Controllers (PLC and Distributed Controll Systems (DCS).
The right to privacy encompasses the right to control the dissemination of information about one's private life.
This paper details the investigation into the design and control of merging bottlenecks of conveyor-based baggage handling systems, encompassing the merging control algorithm and the impact of the merge's physical layout.
The challenges in the area encompass the deliberate control of structure, and therefore the properties and function, as many synthetic factors play a subtle role in the crystallization of MOFs.
For all animals, a PCR fragment of 1138 bp encompassing the mtDNA control region (np 15718-517) wasequenceded using the oligonucleotide 15757for, 5' CCCCAAAGCTGAAGTTCTAT 3', as previously described [9].
These stingray sequences probably correspond to functional genes because they encompass the internal control regions (ICR) within the coding segment (i.e., box A, internal element and box C) and the poly-T motif at the end of the coding region.
Future work encompasses the development of a controlled drug delivery system including a micropump, a drug reservoir, and MNs, with the aim of developing a cost-effective system to deliver drugs to the patient in a precise and painless manner.
Several principal possibilities have been suggested to explain this apparently universal accumulation of damaged/misfolded proteins, including a diminished capacity for protein quality control, which encompasses the removal of damaged and misfolded proteins by the proteasome [ 4, 7].
