Your English writing platform
Discover LudwigSuggestions(2)
Exact(11)
North Lanarkshire encompasses a portion of the Midland Valley (Central Lowlands) extending from the valley of the River Clyde in the west to the upper valley of the River Almond in the east.
To the south is James Bay, which encompasses a portion of the Inner Harbour (including the Parliament Buildings [1897]), but its main orientation is to the Juan de Fuca Strait, on its south.
The national preserve encompasses a portion of the western-slope watershed of the Sangre de Cristo, from the base of the mountains to the crestline; elevations often extend above 13,000 feet (3,960 metres), and there are numerous alpine lakes and wetlands.
Glacier encompasses a portion of the northern Selkirks and a narrow strip of the northern Purcells.
A riparian zone encompasses a portion of the city in the southeast.
The monument is the centrepiece of a 100 ha preserved battlefield park that encompasses a portion of the ground over which the Canadian Corps made their assault during the Battle of Vimy Ridge, a military engagement fought as part of the Battle of Arras.
Similar(49)
Its canton, the white star on a blue field, is derived from the so-called Original Lone Star flag, a banner first flown in 1810 by the short-lived Republic of West Florida, which encompassed a portion of modern Louisiana.
So far TruePosition is the only company with a signed commercial contract: Greater Harris County, Tex. — encompassing a portion of Houston and its outlying areas — signed up in June.
The resulting allele, tap 125, lost a 1.33-kb genomic region encompassing a portion of the longest common exon shared by all putative tap isoforms.
We analyzed only strains belonging to supergroup A and B and having sequences of equal length encompassing a portion of both flanking genes.
The forward primer 5'CCCCTandTAACCGGTGGTC3' and reverse primer 5'GAAGCGGCGAATATCTCACA3' were used to amplify a 113-bp region of the Arabidopsis nuclear DNA encompassing a 5' portion of the nuclear ROC1 gene and an upstream intergenic region.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com