Sentence examples for encompass a pair of from inspiring English sources

The compositional operators (bullet _mathrm{c}) of system algebra encompass a pair of synthetic and analytic operations forcreating complex systems based on existing ones, and vice versa, i.e.: begin{aligned} bullet _mathrm{c} buildrel wedge over = {uplus,pitchfork }. end{aligned} (22 The mathematical models of compositional operators of system algebra are summarized in Table 4.

Genes encoding double mutant CTB (dmCTB) encompassing a pair of amino acids to be replaced with cysteine residues either at the N-terminal (T1C/T92C, Q3C/T47C), C-terminal (F25C/N103C, Y76C/N103C), or at the internal α-helix region (L77C/T78C), were engineered.

The highest sensitivity of hemodynamic changes in the lateral cortical region encompassing a pair of optodes is expected to be localized at the midpoint between the optodes (Okada et al. 1997), and this point is the location of a channel.

Moreover, sampling per "species" was often limited to one locality encompassed by a pair of Madagascar's larger rivers.

Because the boundaries of regions with copy-number losses are thought to be responsible for particular genomic breaks, we defined breakpoints as regions encompassed by a pair of probe sets located inside and outside the boundary of the loss.

The most recent event appears to have been a single tandem duplication of 7 PRAME homologues to generate a pair of segments encompassing genes Homo_19 25 and genes Homo_26 32.

The single-transcript organization was confirmed by RT-PCR using a pair of primers encompassing snoR775 and miR775 (data not shown).

To determine the tissue expression of the two duck splice variants, semi-quantitative RT-PCR was carried out with total RNA from twelve duck tissues and a pair of primers encompassing the region corresponding to the O-linked sugar region.

The simplest mobile element, the insertion sequence (IS), encompasses only a transposase enzyme and a pair of short inverted repeat sequences that flank the transposase gene and function as recognition sites where the DNA breaking joining reactions occur.

Using a pair of primers encompassing the predicted Cnidoin sequence (forward: ATGTCTCGATTACTACTTC, reverse: TTATCTCTTTTTACCAAAAGCTCC), a PCR was performed and the purified PCR product was ligated into the pGEM-T Vector (Promega, Madison, WI, USA) by TA cloning and the sequence was verified by automated sequencing.

It encompasses a new job, an unfaithful boyfriend, a pair of sexy but painful shoes, a coveted day care slot.