Sentence examples for encoding allele from inspiring English sources

Specific primers (PIK-qF: TGCAAAGAATCAGAACAATGCC; PIK-qR: CACGGAGGCATTCTAAAGTCA) were designed for this genomic real-time PCR of PIK3CA encoding allele from paraffin-embedded specimens.

Compared to the proline encoding allele, the arginine allele appeared to trigger a more pronounced apoptosis response, whereas the proline allele induced significantly more G1 arrest [ 8, 10, 13].

First, the expression of NK1.1 antigen on NOD DNCD3 splenic cells has been ruled out, since the NOD mouse strain like the C57BL/6 and SJL strains lacks the NK1.1 encoding allele.

Using a functional approach, they cloned both forms of the 3' SLC6A4 UTR into plasmids; one construct encoded allele G and the other one allele T of rs3813034, and the remaining sequence was identical.

For these studies we constructed strains that express a genomically encoded allele with either five tandem copies of the Flag epitope (Flag) or eGFP tag positioned at the N-terminus.

The non-ancestral allele encoding Ile289 (allele T of rs10502151) is associated with a common haplotype (HMB1) that has a frequency of 23%, whereas the remaining four haplotypes, HMA1, HMA1a, HMA2 and HMA2a, are associated with the ancestral allele encoding Val289 (allele C of rs10502151).

We also describe a novel NDM-encoding allele, designated blaNDM-6.

The mutation of rs316607577 was a nonconservative substitution of serine by glycine (S1072G), with the glycine-encoding allele being associated with stronger eggshell.

Positional cloning revealed that rim1 encodes an allele of AtICln (I, currents; Cl, chloride; n, nucleotide).

cdc10-2E encodes an allele of the Cdc10 subunit of the MBF G1/S transcription factor that mimics Cds1 checkpoint phosphorylation by the substitution of two serines with glutamates.

rmr7 encodes an allele of mop2 (Stonaker et al. 2009).