Sentence examples for encoding allele from inspiring English sources

Exact(3)

Specific primers (PIK-qF: TGCAAAGAATCAGAACAATGCC; PIK-qR: CACGGAGGCATTCTAAAGTCA) were designed for this genomic real-time PCR of PIK3CA encoding allele from paraffin-embedded specimens.

Compared to the proline encoding allele, the arginine allele appeared to trigger a more pronounced apoptosis response, whereas the proline allele induced significantly more G1 arrest [ 8, 10, 13].

First, the expression of NK1.1 antigen on NOD DNCD3 splenic cells has been ruled out, since the NOD mouse strain like the C57BL/6 and SJL strains lacks the NK1.1 encoding allele.

Similar(56)

Using a functional approach, they cloned both forms of the 3' SLC6A4 UTR into plasmids; one construct encoded allele G and the other one allele T of rs3813034, and the remaining sequence was identical.

For these studies we constructed strains that express a genomically encoded allele with either five tandem copies of the Flag epitope (Flag) or eGFP tag positioned at the N-terminus.

The non-ancestral allele encoding Ile289 (allele T of rs10502151) is associated with a common haplotype (HMB1) that has a frequency of 23%, whereas the remaining four haplotypes, HMA1, HMA1a, HMA2 and HMA2a, are associated with the ancestral allele encoding Val289 (allele C of rs10502151).

We also describe a novel NDM-encoding allele, designated blaNDM-6.

The mutation of rs316607577 was a nonconservative substitution of serine by glycine (S1072G), with the glycine-encoding allele being associated with stronger eggshell.

Positional cloning revealed that rim1 encodes an allele of AtICln (I, currents; Cl, chloride; n, nucleotide).

cdc10-2E encodes an allele of the Cdc10 subunit of the MBF G1/S transcription factor that mimics Cds1 checkpoint phosphorylation by the substitution of two serines with glutamates.

rmr7 encodes an allele of mop2 (Stonaker et al. 2009).

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: