Sentence examples for enabling to detect from inspiring English sources

Exact(5)

The functional group potential and the membrane-exposed residues display the largest energetic changes enabling to detect native-like structures from decoys.

The goal is to implement inside network devices algorithms enabling to detect, isolate and compensate communication faults in an autonomous way.

In each case, 3 primers were used enabling to detect both WT and KO allele: for RAG-1 KO mice: fwd5'CAATGTGCAGCTCAGCAAGAAACT3' rvs5'TTCCAGACTCACTTCCTCATTGCA3' neofwd5'GCATCGCCTTCTATCGCCTTCTTGACG3' (WT band  = 421 pb; KO band  = 600 pb); for RAG-2 KO mice: fwd5'GGGAGGACACTCACTTGCCAGTA3'-rvs5'AGTCAGGAGTCTCCATCTCACTGA3'- neofwd5'CGGCCGGAGAACCTGCGTGCAA3' (WT band  = 263 pb; KO band  = 350 pb).

To detect high-risk HPV in adenocarcinomas Hybrid Capture 2 test (enabling to detect but not to discern HPV 16 and HPV 18) was used.

This is one of the first studies using high-density oligonucleotide arrays to survey chromosomal imbalances in conventional BRAFmut and BRAFwt PTCs enabling to detect microdeletions/microamplifications (usually < 1 Mb) affecting known or yet unknown genes related to thyroid cancer.

Similar(55)

These new feature sets usually do achieve better and better performance in terms of detection rate and enable to detect most stego algorithm for most embedding rates.

Second, the detection can be highly sensitive and specific and third, it enables to detect tumors up to centimeters deep in tissue [ 15].

The cost-effective aptasensor enables to detect CEA over a range from 1 to 50 ng ml−1 and the detection limit of CEA was 1 ng ml−1.

This strategy enables to detect weak targets and to circumvent the data association problem originating from the detection stage of classical radar systems.

"Reaction Microscopes" enable to detect the momentum vectors of several electrons and ions after the fragmentation of atoms or molecules.

In addition, it also enables to detect pores in the material surface by varying the total pressure difference between the measuring chambers.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: