Your English writing platform
Discover LudwigExact(1)
MDS is a method similar to principal component analysis that enables high level representation of RNA Seq data based on similarities in expression of 500 genes with the largest fold change difference in the data set.
Similar(59)
SSH combines cDNA hybridizations with polymerase chain reaction (PCR) and enables high level-expressed genes not to be cloned and genes which are specific to certain structures, generally low expressed, to be selected [ 9, 13], contributing to characterize novel genes which may determine virulence, resistance to drugs, and infectivity.
Plant virus expression vectors represent a technology that enables high levels of pharmaceutical proteins to be produced in a very short period of time.
The orange gene (Or) was also identified, which encodes an enzyme that is important for regulating the accumulation of carotenoids through the differentiation of chromoplasts and enables high levels of carotenoid accumulation in cauliflower and potato.
To enable high level expression in Escherichia coli, pduS was amplified by PCR using pAR3114 as a template and 5'-CGCCATATGAAGACAGCTATGACGGCAG-3' as the forward primer and 3'CGCACTAGTTAACCTCTTATTACCGTGATGGATTGC 5' as the reverse primer.
This suggests that the protein folding capacity was greater in strain Sc[ C.l.cbh2b] than for the other strains, which enabled high level secretion of C.l.CBH2b.
Regardless of the microarray platform, cyanine dyes (Cy3 and Cy5) are one of the most widely used fluorescent dye pairs for microarray analysis owing to their brightness and ease of incorporation, enabling high level of assay sensitivity.
This has been attributed by Aiken and others to the sustained implementation of a "bundle" of HRM interventions that fit with organisational priorities and that support autonomous working by nurses, enable participation in decision making, facilitate career development and enable high level skills to be deployed effectively.
The novelty of the method lies in the topological decomposition of objects that enables high-level semantic grasp planning.
Plastid transformation enables high-level expression of foreign genes and the accumulation of recombinant proteins in plastid organelles.
The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com