Sentence examples for enable high level from inspiring English sources

To enable high level expression in Escherichia coli, pduS was amplified by PCR using pAR3114 as a template and 5'-CGCCATATGAAGACAGCTATGACGGCAG-3' as the forward primer and 3'CGCACTAGTTAACCTCTTATTACCGTGATGGATTGC 5' as the reverse primer.

This has been attributed by Aiken and others to the sustained implementation of a "bundle" of HRM interventions that fit with organisational priorities and that support autonomous working by nurses, enable participation in decision making, facilitate career development and enable high level skills to be deployed effectively.

In contrast, modern CIs enable high levels of speech recognition with the CI alone for the great majority of users.

Fractional calculus provides an alternative approach where complex dynamical systems can be modeled with compact fractional equations that not only can still guarantee analytical solutions, but can also enable high levels of order reduction without compromising on accuracy.

This would enable high levels of clinical relevance to teaching and research programmes within the university and facilitate postgraduate recruitment.

Techniques that enable high levels of transgene expression in plants are attractive for the commercial production of plant-made recombinant pharmaceutical proteins or other gene transfer related strategies.

Like other phagocytes, dendritic cells require opsonins to enable high levels of phagocytosis of C. neoformans with contribution from the mannose receptor.

The current reductions in the cost of anti-retroviral therapy (Eg. due to generic manufacture) may enable high levels of anti-retroviral use to be achieved in many Asian countries.

This pH-programming method will enable higher level, complex structures to be formed that cannot be accessed by simple thermal gelation.

This suggests that the protein folding capacity was greater in strain Sc[ C.l.cbh2b] than for the other strains, which enabled high level secretion of C.l.CBH2b.

Regardless of the microarray platform, cyanine dyes (Cy3 and Cy5) are one of the most widely used fluorescent dye pairs for microarray analysis owing to their brightness and ease of incorporation, enabling high level of assay sensitivity.