Sentence examples similar to employed full length from inspiring English sources

Suggestions(1)

Similar(60)

Two different types of in vitro reconstitutions were tested employing full length Tsr, CheA, and CheW.

In a yeast two-hybrid screen employing full-length murine PrP (aa 23 231) as a bait we identified three peptide aptamers that reproducibly bind to PrP.

The protein-level calibration method employs full-length protein as the calibrator and full-length SIL-protein as I.S., which is spiked directly into samples before sample preparation.

The procedure described here employs full-length cDNA expression libraries derived from a given tissue or cell line, which brings advantages and disadvantages, compared to arrayed collections of open reading frames (ORFs).

The Aqp1b-Ct1a cDNA was then amplified using the PCR product as reverse primer and a forward primer specific to the 5' end of Aqp1b, with an EcoRV site (5'-GATATCTCGACGCGGAGATGACAGAA-3'), employing full-length Aqp1b cDNA as a template.

The overall workflow of the current work is to employ full-length cDNA available in the model plants Arabidopsis and rice to precisely pinpoint the TSS for miRNA genes, and then use such information to analyze and compare the promoter features between the two species.

I am also employed full time.

84% were employed full time.

Contrast: employed full-time vs not employed full-time.

To analyze expression induced by our new construct, we employed five different full length IgGs.

A forward primer annealing on ANRIL exon 1 found in all described alternative transcripts (Exon1F ctcgtcgaaagtcttccattct) and reverse primers annealing on exon 13 of the shorter transcript (Exon13R caagatagagaagcaggtatc) and exon 19 of the longer transcript (Exon19R atacagaaagatgaaaagtgatttgcc) were employed to amplify full length transcripts as described [9].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: