Your English writing platform
Discover LudwigSuggestions(5)
Exact(1)
Accordingly we will employ improvements of the methods for uniformly elliptic equations in [25] with a critical adjustment used to supplement the tangential gradient terms in [25], which is similar to that used for gradient estimates in the conformal geometry case in [19].
Similar(59)
It works acceptably with a restricted vocabulary, but try anything more free-range and it mistakes at least one word in four.The translator Mr Rashid demonstrated employs several improvements.
While the returned PIs are poor when single-objective swarm optimization is employed, substantial improvements are recorded when a multi-objective framework is considered for ANN development.
System 3[18] employs recent improvements in speaker segmentation of two-speaker telephone conversations using eigenvoice modeling[23] and the traditional agglomerative hierarchical clustering[1, 24], similarly to the speaker segmentation technique proposed in[12].
C6 Proven method application (Validity) Maximum To propose and employ an improvement process in any organization, it is crucial for them to apply a valid and proven version of the proposed procedure.
Many of the tests and measures employed showed improvements in both groups, which could be due to a potential 'placebo effect', or possibly a greater participant understanding of how to perform the trial (Laursen et al. 2003).
Illumina primers: pr1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT pr2: CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT Sequencing of the RESCAN libraries started with 25b reads on the original (2007) Genome Analyzer and progressively employed the improvements in chemistry and apparatus.
If Contribution Mapping is employed for improvement purposes, the results could inform the formulation and execution of plans for improvement.
The adaptive local polynomial Fourier transform is employed for improvement of the ISAR images in complex reflector geometry cases, as well as in cases of fast maneuvering targets.
One is response surface method (RSM) [10] which refers to a set of statistical techniques and algorithms of gathering information, which is employed for improvement, extension, and optimization of processes.
In addition to healthcare technologies, hospitals are enhancing internal processes by employing quality improvement programs.
More suggestions(3)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com