Sentence examples similar to emp 1 from inspiring English sources

Similar(60)

The overall change in disease activity (change in global BILAG-2004 scorrelatedelated modestly with change in CD31+/annexin V+/CD42b EMP levels (r=−0.40, p=0.08), although it should be noted that non-linear clinical disease activity indices are limited in their ability to be used in this way.

The paper gives three examples of transient analyses carried out as part of the safety assessment of the target: (1) a beamline trip and recovery; (2) failure of the primary electro-magnetic pump (EMP); (3) failure of the secondary EMP (used to cool the base of the target).

Emp (25 µg/mL) or VEGF (200 ng/mL positive control) (R&D-Systems) was added to the cells previously transfected with VEGFR-2-siRNA and seeded on the upper chamber of the insert.

When the Na+,K+-ATPase blocker ouabain (100 micromol l -1)) was added to the EMP (40 mg l -1)) perifusion, the acute EMP response was eraddedtod.

It's probably better for their mental health more than their physical health (Employer (EMP) #2, m, 64yo, 8 ye).

When the Na+, K+, Cl- co-transport inhibitors bumetanide (10 micromol l -1)), or furosemide (100 micromol -1-1)), were added torEMP (40 mg l(-1)), the acute increase in PCA seen furosemideone was also completely blocked.

The second trial [ 88] reported comparable rates of pain relief (undefined) among patients treated with epirubicin (49%), mitomycin C (48%), and EMP (42%).

Furthermore, emp#2 peptide effectively inhibited the enhanced invasion of matrigel by glioblastoma cells in the co-presence of fibroblasts [ 31].

In addition, two different broad-spectrum recognition receptins that bind several different host proteins have been identified, Map (also known as Eap) and Emp (17, 18).

A blocking primer specific to mammals was used to minimize amplification of host DNA (GCCCGTCGCTACTACCGATTGGIIIIITTAGTGAGGCCCT C3 Spacer), with the design based on Vestheim and Jarman (2008) as described in the EMP 18S protocol.

Twenty-four assessable patients with hormone-resistant prostate cancer (HRPC) were to receive daily doses of oral estramustine phosphate (EMP), 10 mg kg -1), and intravenous epirubicin (EPR) infusions, 100 mg m(-2), every third weekg -1to andumulatintravenous 500 mg m(-2).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: