Sentence examples for emb 1 from inspiring English sources

In the presence of EMB, 1 µM rottlerin, a PKCδ inhibitor, attenuated cytoplasmic vacuole formation and significantly increased the survival rate of RGC-5 cells.

Primers "EMB-1 F3" contained an attB4 site at the 5′ end (5′-GGGGACAACTTTGTATAGAAAAGTTGCTCCTGAAAGTAGCAAAATATACACG) and "emb R2" included an attB3 sites on its 5′ end (5′-GGGGACAACTTTGTATAATAAAGTTGCTCACAACTCTTTTTAATAATTACAG).

emb-1 (hc62ts ) and ok2757 complementation tests: emb-1 (hc62ts ) lon-1 (e1820 ) hermaphrodites were mated with emb-1 (hc62ts ); him-8 (e1489 ) males.

Cross males (emb-1 lon-1 / emb-1 +; him-8 /+) were mated with ok2757 / hT2, and non-GFP L4 cross progeny (emb-1 lon-1 / ok2757 or emb-1 / ok2757 ) were picked to different temperatures.

We have been unable to detect spermatogenesis-associated meiotic arrest defects in either emb-1 (homozygotesmorygotes or in emb-1 (hc62ts )/deletion males.

A similar approach was taken starting with emb-1 (hc62ts ) lon-1 (e1820 ) hermaphrodites crossed with emb-1 (hc62ts ); him-8 (e1489 ) males.

PCR was carried out with primers "EMB-1 F6": 5′-GACTTTGATTCAAAAAACCACG and "EMB-1 R4": 5′-CGAGTCAGAATAGCCACACT to amplify an ∼290-bp fragment.

PCR analysis of these rescued emb-1 (hc62ts ) lines demonstrated that the lines were homozygous for the emb-1 (hc62ts ) allele and contained the transgene (data not shown).

The ok2759 deletion allele was monitored by PCR using primers "EMB-1 F7": 5′-CTGCAGTGGAGCGTACTTGC and "EMB-1 R2": 5′-GGGGACAACTTTGTATAATAAAGTTG.

At 24°, double mutant combinations of emb-1 (hc62ts ) with these suppressor mutations exhibited a partial suppression of the emb-1 one-cell arrest phenotype (Table 3).

To molecularly identify the emb-1 gene product, emb-1 was genetically mapped to a small, ∼370-kb interval on chromosome III between dpy-17 and lon-1.