Sentence examples for elements in the present from inspiring English sources

There appear to be elements in the present situation that may make past experience irrelevant.

By using COSY code it is concluded that the settings of some optical elements in the present design of the beam line should changed to increase the beam transmission.

The Constitution gives a criminal defendant the right to demand that a jury find him guilty of all the elements of the crime with which he is charged; one of the elements in the present case is materiality; respondent therefore had a right to have the jury decide materiality.

In this method, a grid system generated abound the rotor accounts for rigid blade motions, and a new searching scheme named adaptive inverse map (AIM) is established to search corresponding donor elements in the present moving-embedded grid system to translate information among the different computational zones.

Besides the second transformer at Vandellòs, the switched off elements in the present model just included the Vandellòs-Rubí transmission line (other switched off elements far apart are not prone to influence the currents at Vandellòs).

These results established the respective specificity of EBV Rta and K-RTA for their cognate responsive elements in the present assay.

A key element in the present study is that the bed roughness at the three sites has been estimated from predictions of the sand ripple dimensions.

The difference between EFeMnAl and EFe is attributed to the alloying elements (Mn) in the present alloy.

The data elements used in the present study have been collected without changes over the study period from 1993 to 2009.

Such DNA probe at the sequence 5′ GTCAAGACGGTGGTGGGCTG was designed and used as a sensing element in the presented biosensors.

An eight noded isoparametric quadratic element is considered in the present finite element formulation incorporating transverse shear and rotary inertia.