Sentence examples for elements for several from inspiring English sources
Deighton's novels usually contain enough elements for several books.
However, in spite of the evidence of its viability and even of the existence of standard regulations oriented to these elements, for several reasons their use has not been consolidated yet.
The Moshinsky brackets, the matrix elements for several central and non-central interactions between nuclear two-particle states as well as their expansion in terms of Talmi integrals are easily given within a symbolic formulation.
The study indicates that our approach reduces the number of manually specified elements by 29%, and reduces the number of manual changes to elements for several realistic change scenarios by 52%.
In Table1, the calculated intraband matrix elements for several configurations of the dimensions of the structure, applied electric field, and hydrostatic pressure are reported.
In [6 8], compressed sensing (CS) techniques are used to search for a solution over an overcomplete dictionary which consists of basis elements for several velocity-position combinations.
Finding a coupling model between a hydraulic parameter such as permeability and a mechanical parameter such as damage is the key element for several recent engineering problems.
We reported that Fe deficiency-responsive element 1 (IDE1: ATCAAGCATGCTTCTTGC) and IDE2 (TTGAACGGCAAGTTTCACGCTGTCACT) were critical cis-elements for several genes upregulated by Fe deficiency (Kobayashi et al. 2003).
During the following discussion the students analyzed the phenotype of each family element for several traits and realized that the characteristics of one individual are mostly dictated by information coming from their parents.
Magnesium is an important element for several physiologic processes in humans, as the maintenance of bone health and the well functioning of the nervous system, energy metabolism and the synthesis of proteins, DNA and RNA [ 14].
His own work reflected Caro's abstract, formalist sculptures of welded metal elements, and for several years Ray's did, too.
