Sentence examples for elements as previously from inspiring English sources

The model encompassed a 4 µm×4 µm×4 µm volume of simplified neuropil composed of cuboidal elements, as previously described [31], [32].

The ExCh molecules contained the same elements as previously described in AS1-E24 and AS2-E24 TS molecules followed by a 5' donor splice site (5'SS) [15] and a second 150 nt antisense targeting intron 23.

To estimate global DNA methylation content we performed DNA methylation analyses of Alu and LINE-1 repeated sequences, which allow for the amplification of a representative pool of repetitive elements, as previously described [30].

Overall, these results highlight the reliance of L. casei strains on CRISPR-Cas systems to provide immunity against invasive elements, as previously shown in bacteria and archaea [ 57, 59, 60, 76, 77].

Although crosstalk can occur between DDT signaling estrogen response elements, as previously shown (Bratton et al. 2009), the results presented here strongly suggest that DDT-altered VEGFA expression in MCF-7 breast cancer cells is ERα independent.

Such simplicity has evolutionary implications: it may allow variation in circuit structure and ultimately in behavior, through evolution of cis-regulatory elements, as previously shown for somatic characters, such as wing spots (Prud'homme et al., 2007).

Association signals were considered for SNPs within ±250 kb of the 60 candidate genes to identify any distant regulatory elements, as had been previously reported from QTL fine mapping studies of the Vgt1 and tb1 genes (Clark et al. 2006; Salvi et al. 2007).

As a control, a mutated version of this promoter was synthesized (Medigenomics) to contain four point mutations in each SRE element as previously reported [49] (AAAAGAACCCCTATGCAAACTCCTCCCCCTGC, mutations underlined).

Hence, the invasion of the iAbi11 intron heg by a heg arising from an other gene (cob) suggests a recent transfer activity of the enzyme encoded by the mobile invading element, as previously reported in the T4 phage and in the fungus Podospora curvicolla [21], [22].

The use of the IS 6110 insertion element as the PCR target could be a potential source of decreased sensitivity, since MTB lacks this element, as previously reported.

EMSA was performed on nuclear extracts with a double stranded 19-mer oligonucleotides containing the AP-1 binding motif, TGACTCA 12-O-tetradecanoylphorbol-13-acetate 12-O-tetradecanoylphorbol-13-acetate 12-O-tetradecanoylphorbol-13-acetate 12-O-tetradecanoylphorbol-13-acetate 12-O-tetradecanoylphorbol-13-acetate