Sentence examples for element was generated from inspiring English sources

Exact(6)

Rock type and ambient stress state are rather homogenous across the planned GeoLaB tunnel and hence to solely assess the influence of topography on the stress field distribution near the Wilhelminenstollen, a finite element was generated for an area of 19 × 20 km around the Wilhelminenstollen (Fig. 6b) with a vertical extension from the topography down to 5 km b.s.l.l

Probe to Tlr1 element was generated by directly labeling Tlr1 PCR product with Cy5 (Primers: Forward - TCGGATCGGATTGGATTAAC, Reverse -CCTGGAGCTTACCGTCTTTG; Aglient Genomic DNA ULS labeling kit 5190-0419).

This FIRE-containing conserved intronic element was generated by PCR of genomic DNA using the primers 5′-AGAAAGATAAAAGCATTGCACA-3′and 5′-CCCCATT-TTGCCACATCAGCGAG-3′ to produce an 820 bp product, using Thermo Scientific Phusion High-Fidelity DNA Polymerase.

A library of 3000 unique insertions of the Gene Search (GS) element was generated by mobilizing the GS element from the X chromosome (DGRC number 200079) to the autosomes by crossing with flies expressing the Delta2-3 transposase.

The 3 × NF- κBluc reporter vector, containing a triplicate NF- κB response element, was generated by subcloning from a 3 × NF- κB- βgal reporter vector (kindly supplied by Professor Stefano Schiaffino, University of Padova, Padova, Italy) into the pGL3basic reporter vector (Promega, Madison, WI, USA).

In order to identify novel genetic modifiers of Aβ toxicity in the fly, a library of 3000 unique genomic insertions of the gene search (GS) mobile genetic element was generated and the effect of the consequent gal4-dependent modulation of neighboring gene transcription on the lifespan of flies expressing the Arctic variant (E22G) of Aβ42 [43] was assessed.

Similar(54)

Runoff from an element is generated only when its saturation threshold is exceeded.

This element is generated in such a way that the user can select as many numbers of nodes as desired.

Finally, the kinetics element is generated.

In Figure 7a, we find that the model chorus element is generated at the equator and is propagating away from the equator.

Using group I permuted-intron-exon sequences, circular forms of the HDV ribozyme, the RNA component of RNaseP from B. subtilis, the HIV TAR and a short HIV Rev-binding element were generated and tested for activity and stability.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: