Sentence examples for element is generated from inspiring English sources

Exact(6)

Finally, the kinetics element is generated.

Runoff from an element is generated only when its saturation threshold is exceeded.

This element is generated in such a way that the user can select as many numbers of nodes as desired.

In Figure 7a, we find that the model chorus element is generated at the equator and is propagating away from the equator.

In order to commit and assign accurate bandwidth assigned to a SS, SDBG utilizes the three parameters, i.e., QoS precedence, bandwidth request, and wireless channel condition obtained from SS, and an element is generated by the BS itself, which is the bandwidth allocation history.

RiRi, always on the right, and LuLa, always on the left, wear gray jumpsuits wrapped with black tape that looks sort of like bondage and sort of like the costume Milla Jovovich wears when her character in the Fifth Element is generated in a lab.

Similar(54)

Probe to Tlr1 element was generated by directly labeling Tlr1 PCR product with Cy5 (Primers: Forward - TCGGATCGGATTGGATTAAC, Reverse -CCTGGAGCTTACCGTCTTTG; Aglient Genomic DNA ULS labeling kit 5190-0419).

A library of 3000 unique insertions of the Gene Search (GS) element was generated by mobilizing the GS element from the X chromosome (DGRC number 200079) to the autosomes by crossing with flies expressing the Delta2-3 transposase.

This FIRE-containing conserved intronic element was generated by PCR of genomic DNA using the primers 5′-AGAAAGATAAAAGCATTGCACA-3′and 5′-CCCCATT-TTGCCACATCAGCGAG-3′ to produce an 820 bp product, using Thermo Scientific Phusion High-Fidelity DNA Polymerase.

During the tracing process, a set of pixels outlining part of the object's boundary is analysed and a group of vector graphical elements is generated.

A three-dimensional close-actual-breast model is generated and a numerical grid with tetrahedral elements is generated.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: