Your English writing platform
Discover LudwigExact(3)
A key element in the present study is that the bed roughness at the three sites has been estimated from predictions of the sand ripple dimensions.
A core element in the present paper is formed by a smart urban dashboard system that acts as an interactive navigation tool supporting operational choices of all stakeholders involved.
A new element in the present approach is the use of the summation-by-parts formalism to develop stable non-stiff first-order derivative approximations at the irregular grid points.
Similar(57)
Such DNA probe at the sequence 5′ GTCAAGACGGTGGTGGGCTG was designed and used as a sensing element in the presented biosensors.
There appear to be elements in the present situation that may make past experience irrelevant.
Besides the second transformer at Vandellòs, the switched off elements in the present model just included the Vandellòs-Rubí transmission line (other switched off elements far apart are not prone to influence the currents at Vandellòs).
These results established the respective specificity of EBV Rta and K-RTA for their cognate responsive elements in the present assay.
Unlike a centralized metadata management solution which can serve as the single source of truth for all metadata attributes referenced by other systems, metadata elements in the present investigation were obtained from different systems.
The difference between EFeMnAl and EFe is attributed to the alloying elements (Mn) in the present alloy.
The data elements used in the present study have been collected without changes over the study period from 1993 to 2009.
An eight noded isoparametric quadratic element is considered in the present finite element formulation incorporating transverse shear and rotary inertia.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com