Sentence examples for element employed from inspiring English sources

The impact sensing element employed was a thin circular diaphragm of flexible Phynox alloy.

The sensing element employed was a stack of piezoelectric plates which measured three components of the force directly.

The delay element employed in the ring oscillator topology consists of two CMOS inverters loaded by a simple negative resistance realized with pMOS transistors.

The finite element employed in the study is based on field-consistency approach and free from shear and membrane locking problems.

However, this was a common decorative element employed in the region at the time, and archaeologists have noted that in this region of limited forests it is much more likely that packed earth, rather than expensive timbers, was used to support the form on which the arch was constructed.

Along with their entirely in vitro development process the use of animals or cells is not required these attributes have made aptamers an attractive recognition element employed in a variety of analytical applications [ 12– 12].

A conventional angle diversity receiver uses multiple receiving elements that are oriented in different directions, where each element employs its own filter and nonimaging concentrator, such as a compound parabolic concentrator (CPC) or hemispheric lens.

A conventional angle diversity receiver uses multiple receiving elements or branches that are oriented in different directions, where each element employs its own filter and nonimaging concentrator, such as a CPC or hemispheric lens.

The most widely used spatial ANCF beam element employs linear approximation in the transverse direction, thereby restricting the cross section deformation and leading to locking problems.

3D7 var2csa (PFL0030c) was PCR amplified from 3D7 genomic DNA with primers PFL0030c/F (AAATGGAAATCCGAATGGG) and PFL0030c/R (TGAGTCAAGGGTGTGTTCTTGGGGGTAAACC) and then ligated into a T7 3' element employing the TOPO-Tools system (Invitrogen) as recommended by the manufacturer.

The Baroque twisted upright was one of the chief elements employed.