Sentence examples for either terminal from inspiring English sources

Though nothing either terminal or unique.

The text is presented in three general sections according to the dimensionality of the coordination polymer, and then is subdivided in sections that take into account the structural role of the nucleobase as ligand (either terminal or bridging), and the nature of the nucleobase (pyrimidine vs purine).

Thus, accurate delineation of the nature of the imbalance, either terminal or interstitial, is crucial for diagnosis and prognosis.

No other potential myristoylated glycines either terminal or internal were found among the rest of the OsCML proteins.

In liquid culture and depending on the condition of culture, Frankia forms hyphae and multilocular sporangia which are located on hyphae either terminal or intercalary [ 20].

In addition, there was no significant association of cave and surface haplotypes with the position (either terminal or interior) of those in the network (P = 0.28).

Loss of TGF-β1 did not increase the proliferation of ER-α-positive cells in either the terminal end buds or ducts, although proliferation was increased overall.

We also assume that every channel, either between terminals or from terminal to destination, has the same SNR.

If the IME-EF4 has the protruding cohesive end situation according to cases 1, then there would be signals after either the terminal sequence GAGATTCGTTTAAGCGAAAG, ATTTTTTGAAGAAACTAATA, or both of them in the terminal run-off sequencing result.

Interestingly, the five class 1 mutations with the least negative PROVEAN score are those found either C-terminal or N-terminal of amino acids 529 542 (Fig. 1d).

Either the terminal position of the first front lies above the bottom of the barrier, or it lies below.