Sentence examples for efficient at reducing from inspiring English sources

Exact(35)

A treatment scenario that focused on treating defensible space near homes was by far the most efficient at reducing WUI exposure, including exposure transmitted from USFS lands.

Instead, 'leaky dams' or wood and peat combination dams were used, which are both more efficient at reducing and diverting the flow, and longer lasting than bale dams.

The smarter members of the Coalition know full well that the carbon price they dismantled was more effective and efficient at reducing emissions than the Direct Action plan they have replaced it with but inefficiency and ineffectiveness of climate policy is a small price to pay for power.

We concluded that feeding PG as a dry product reduced plasma BHBA concentration but top-dressing PG was more efficient at reducing plasma BHBA level than incorporating PG into the TMR.

When unsteady state analysis of thermal effects is conducted only for important parts of the die, a combined method of steady and unsteady state thermal analysis, which was introduced to estimate a steady heat cycle required to evaluate die life, was more efficient at reducing computation time.

They're also 16% more effective at turning the talent acquisition process into a competitive advantage, and 13% more efficient at reducing candidate screening times.

Show more...

Similar(25)

It can, of course, resize images too, but Bluefive's PIXresizer is super-efficient at reducing file sizes.

Under the Obama administration, the Department of Justice has taken major steps to make our criminal justice system more fair, more efficient, and more effective at reducing recidivism and helping formerly incarcerated individuals contribute to their communities.

Competitive RT PCR showed that the DUSP6 siRNA targeting AAGTGCGGAATTGGTTAATAC, and the RGS16 siRNA targeting AACAAGGCAGAAAAGGATCCT, were the most efficient siRNAs at reducing the expression of each gene.

This model showed that aromatase inhibitors are more efficient than tamoxifen at reducing tumor volume.

Adaptive decision-making is a structured process of learning, improving understanding, and ultimately adapting management decisions in a systematic and efficient way, aimed at reducing uncertainties over the course of the management timeframe.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: