Sentence examples for easy tube from inspiring English sources

In such situations, Easy Tube or combitube may be safe against aspiration and can therefore be used in vomiting or bleeding patients unless the glottis cannot be visualized.

By adding an elastic top to a pillowcase, you can make a quick and easy tube dress.

As well as making the form filling easier, Tube Refund could also help solve the problem of actually remembering to file the claim itself.

The aim of this work was the design and validation of a rapid and easy single tube multiplex-PCR (m-PCR) assay for the unequivocal differential detection of Mycobacterium bovis and Mycobacterium tuberculosis.

An amount of 0.4 µg (for A549 or HEK293) or 0.2 µg (for HeLa) TrxR1 or SecTRAPs preparations (as described in the text) in TE-buffer (2 mM EDTA, 50 mM Tris-Cl, pH 7.5) was diluted in PBS to a final volume of 20 µl subsequently added to a "quick easy" BioPORTER tube (Gene therapy systems) by pipetting up and down 10 times to hydrate the dried compound.

The method is an easy, single-tube, end point assay utilizing standard thermal cyclers and PCR reagents.

The pellet was purified membranes which were resuspended in 2 mL gradient buffer by homogenization and mixed with 1.9 mL Percoll (Amersham Biosciences, Uppsala, Sweden containing 10% PBS and 0.19 mL 2.5 M sucrose in an Easy-Seal tube (polyallomer, 5 mL, Sorvall).

We showed that the Airtraq coupled to an iPhone with its dedicated AirView app allowed quicker identification of epiglottis and intubation as well as easier tracheal tube insertion on an airway manikin simulating difficult intubation than the King Vision by experienced anaesthetists.

The Duchess, in her rather sexy and slightly husky French accent, would appear in adverts recommending Vitapoint, a hair gel for women which came in an easy-to-use tube.

Reverse transcription (RT -PCR was peRT -PCR wash an Agilent Easy-A One Tube RT-performedusing 2 μl of RNA, an annealing temperature of 55 °C, and the followith primers: CyanAgilent GGGTTGGAAGGGAGCCATTTG and Primer H: CTTTCGAAGGACGACTTGC.

For an easy fix, buy tubes of cookie dough.