Your English writing platform
Discover LudwigExact(3)
Thus, the inhibition by SXL should occur at an early splicing step as the amounts of both splicing intermediates were decreased, but the ratio of the two bands remained the same.
Here we focus particularly on the major spliceosomal snRNAs involved in mRNA splicing, and address the question whether these small snRNAs occur in all deep eukaryotic lineages; in other words, whether the early splicing mechanism in eukaryotes involved both RNA and proteins, or was initially a protein mediated process, with RNAs added later.
Comparison with PTB crosslinked to a TPM1 substrate (Cherny et al., 2010) showed that the band comigrated with U2AF65, a protein required for the assembly of early splicing complexes that binds to 3′ss polypyrimidine tracts.
Similar(57)
Early splice site choice in mammals involves protein-protein interactions across the exon, as is proposed in the exon definition model of Berget [ 21].
The early splice site recognition literature often oversimplified the composition of the U1/U2-type 5´ donor and 3´ acceptor sites by presenting only consensus sequences and truncating the positions in each site.
From Rosetteless, we sequenced 11 clones that had retained intron 7 (isoform ii), 3 clones that had a late splice donor (isoform iii), and 21 clones that had an early splice donor (isoform iv), but no clones with the wild-type isoform.
This PTBP2-driven splicing transition takes place subsequent to the earlier splicing switch driven by PTBP1 depletion as neurons are born.
In the earliest splicing step, the donor splice site is recognized by the spliceosomal small nuclear ribonucleoprotein U1-snRNP [22], and particularly by its RNA component (U1-snRNA).
These sequences are among the earliest spliced transcripts of the integrated provirus.
As discussed earlier, splice isoforms that contain all of exon AB or exon C are enzymatically inactive, while isoforms that contain only a portion of exon AB (A or A′ sectors) produce β-gal activity similar to that of the classic fusion protein (which lacks any hPLP1 intron 1-derived sequence).
RT-PCR reactions of the JCV-early region splicing were performed by using following primers: PF (Mad-1 4801-4780): 5'- CCTGATTTTGGTACATGGAA -3' and PR (Mad-1 4291 - 4313: 5'-GTGGGGTAGAGTGTTGGGATCCT -3'.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com