Sentence examples for each termini from inspiring English sources

The stem-loop structured oligodeoxyribonucleotide (ODN) having a molecular beacon sequence for point mutated K-ras mRNA was doubly labeled with bis trifluoromethyl benzene moiety and Gd-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid chelate moiety at the each termini of the ODN probe, respectively.

Potential imperfect inverted repeats were also predicted in the sequences adjacent to each termini of the SMReV positive-sense strand.

The program considers a region a putative LTR if the total length of the direct repeat is greater than 100 bp and starts/terminates within 20 bp of each termini of the query.

In order to incorporate restriction site sequences at each termini of the 601 sequence, plasmid DNA was used as a PCR template using the following primers: forward 5′ – CTCGGAATTCTATCCGACTGGCACCGGCAAG – 3′ (EcoRI) and reverse 5′ – GCATGATTCTTAAGACCGAGTTCATCCCTTATGTG – 3′ (Bst98I).

There are no buffet cars, and train staff are expected to clean up the carriages at each terminus.

Two phosphofructokinase (PFK) chimeras were constructed by exchanging the N- and C-terminal halves of the mammalian M- and C-type isozymes, to investigate the contribution of each terminus to the catalytic site and the fructose-2,6-P2/fructose-1,6-P2 allositeic site.

Turntables were placed at each terminus.

For effective annealing, one more nucleotide was added at each 5' terminus [10].

To enrich for targeting SLiMs, we restricted analysis to the 20 amino acids at each terminus.

For clonal amplification and sequencing on the Genome Sequencer FLX, the sscDNA required the addition of adaptors to each terminus.

The telomeres on each terminus of the T.pigmentosa Mt genome were different as previously found by Morin and Cech [24], [25].