Sentence examples for duplicated form from inspiring English sources

"They reported the reach in duplicated form".

Interestingly, the duplicated form of ptpn23, a catalytically inactive PTP, has lost its PTP domain, indicating that PTP activity is not required for its function, or that ptpn23b has lost its PTP domain in the course of evolution.

In the case of the chlorophyte lineage, it appears that it has been the groEL1 form that has been lost, and in Chlamydomonas and higher plants, this has been replaced by a duplicated form of a groEL2-like sequence.

The DNA is organized in a set of chromosomes, which have in their duplicated form two identical subunits, called chromatids, that are held together by a centromere (not to be mixed up with centrosome).

Additional experiments were performed with sequence variants of Pep19-2.5 Pep19-2.5e duplicated form, Pep19-2.eDup, the variant with all amino acids in a D-configuration (Pep19-2.5D-AA), and a varianthen which the final sequence at the C-terminus is lacking (for sequences see Table 1).

In particular, PCR amplifications were performed with JumpStart AccuTaq LA DNA Polymerase (Sigma-Aldrich) and two sets of primers: one that amplifies only the duplicated form (F: GTCCTGTGCACCTTGTGTCA; R: CTGATGTATGGTGAGAGAGC) and one that flanks the segmental duplication (F: GTCCATTTCTGTAGCCATAGG; R: TCTGAGTTGTAGGAGAGCACT).

Due to the duplicated nature of the zebrafish genome, bactin2 and bactin1 were duplicated forms of the mammal bactin gene.

Stramenopiles possess duplicated forms of this gene.

First we removed all duplicated forms from all patients and kept only the data from the most current form.

Our phylogenetic analyses showed the Lethenteron japonicum (lamprey) TLRs to be duplicated forms of TLR14 and various fish TLRs to be TLR22.

Arsenal, he invented the lathe that duplicated the form of a pattern object by transmitting to the cutting tool the motion of a friction wheel rolling over the pattern.