Sentence examples similar to drive mer from inspiring English sources
While this analysis demonstrated that Pros1 is sufficient to drive Mer-dependent phagocytosis in RPE cells, the presence of Tyro3 in these cells raised the possibility that Pros1 activation of the Mer kinase might be dependent on Pros1 binding to Tyro3.
The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
A trivial interpretation of the results, therefore, would be that because the candidates have a fly-like k-mer profile, they drive fly-like reporter gene expression without being true regulatory elements in their native species.
Although it is conceivable that sequences coincidentally matching the training set's k-mer profile may exist and drive generally related gene expression, note that each training set encompasses a range of nonidentical expression patterns.
A short drive from Boulogne's putrid vapours is Montreuil-sur-Mer and its windswept fresh air.
The drive from Bournemouth is lined with bloated McMansions squatting behind high, prole-repelling hedges – Bishops Avenue-sur-Mer – before finally giving way at the waterfront to ranks of equally ugly modern flats pockmarked with luxury estate agents' boards.
In two settings of TAM-dependent homeostatic phagocytosis, Mer plays a predominant role while Axl is dispensable, and activation of Mer by Protein S is sufficient to drive phagocytosis.
Recently she drove past Rosecliff, Chateau-sur-Mer and all the other splendid mansions on Bellevue Avenue, where formal rows of antique streetlamps were just coming on.
