Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
The red sludge entered the Danube on Thursday and was moving downstream today toward Hungary's immediate neighbours, Croatia, Serbia and Romania, amid fears that it will kill the river's fish and plant life.
Similar(58)
1962), which contains poems that explore the imposition of existential order through various forms, be they natural or products of the poet's imagination; and Downstream (1962), a collection focusing on war and political and social disruption in modern Ireland.
But the acquisition of Amoco's considerable gas assets has spurred Sir John Browne, BP Amoco's boss, to move a bit further downstream: this month, he launched a new global gas-marketing business.
GPON employs a time division multiplexing (TDM) for downstream (1,480 to 1,500 nm) and time division multiplexing access (TDMA) for upstream (1,260 to 1,360 nm) transmissions.
Installing sewage treatment facilities at major sewage outlet points can reduce the risk of contamination of water resources particularly in downstream spring.
A recent study reported considerable sediment trapping by three large channel bars downstream 18 28 km of the Mississippi Atchafalaya River diversion (commonly known as the Old River Control Structure, ORCS) during the 2011 Mississippi River flood.
Erosion of As-containing mineralisation was observed in the McKinlay River upstream and downstream (23 26 mg/kg) and upstream Ryan's Creek boundary of the Goodall mine lease MLN 1049 24 400 mg/kg).
Both the upstream (CG10795) and the downstream (CG9707) immediately adjacent genes are present (see http://genome.imim.es/datasets/2008selenoinsects/#4).
The contexts of upstream YPR063C and downstream UBA3 YPR066W) genes are also conserved in these three yeasts (Figure 3A).
These findings could suggest that plasmid cpe isolates with downstream IS1151 sequence share a common genetic relationship.
The pair used for the amplification of the region downstream Xac1814 was 3'XAC1814up (5' ATCAGAATTCGTACTGGCGCAATACCTTCAG 3') and 3'XAC1814down (5' ATCAGGATCCGTTGGTTCCACTCAGGCTCAAT 3') rendering a fragment of 1238 bp.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com