Sentence examples for downstream gateway from inspiring English sources

Exact(1)

Phya without the downstream GATEWAY tag was amplify with primer pair Pa-SacF (CTCGAATTCCTTCTCTTTTACTCGTTTAG) and Pa-HindR (TGAGGAAGCTTATCGATGGTACCGCGGCATGCATATGGCACGTCTCTCCTCCTTGCG), the pET-A plasmid was made by inserting the HindIII/EcoRI digested PCR product into the similarly treated pETDuet-1(Novagen).

Similar(59)

Each primer contained an attB1 or attB2 site, respectively, to permit downstream cloning by the Gateway technology (for details cf. InVitrogen Gateway manual).

The T2A-DsRed cDNA was cloned into the p3E entry vector of the Gateway system (Invitrogen), downstream of a multiple cloning site (MCS) (Kwan et al., 2007).

The wireless interface on the gateway n0 implements FQ for downstream traffic.

These observations suggested that these important functional proteins are not only direct targets of the virus but also might serve as a further gateway to the control of downstream factors such as HDFs.

To generate a UAS:BoTxBLC-GFP construct, a codon-optimized cDNA encoding botulinum toxin light chain B serotype (Kurazono et al., 1992; Whelan et al., 1992) was fused in frame with GFP and cloned downstream of the 5× UAS sequence using gateway recombination (Asakawa and Kawakami, 2008).

Our data show that inclusion of the TEV recognition site directly downstream of the recombination site of the Invitrogen Gateway vector resulted in a loss of solubility of the nine mouse proteins.

The TAP-tagged versions of the Importin proteins and nucleoporins were generated as follows: the TAP-tag sequence (streptavidin-binding and calmodulin binding peptides) were amplified by PCR from the InterPlay™ vector pCTAP-A (Stratagene) and cloned downstream of the recombination site of the pDEST14 Gateway™ vector (Invitrogen).

For downstream flows, this source rate limit is akin to per-flow gateway rate limit as the gateway is now injecting packets in the wireless medium.

For downstream flows, this source rate limit is akin to per-flow gateway rate limit as the gateway is now injecting packets in the wireless medium.  .

To express GCaMP3 specifically in cones, we used the Gateway-based Tol2kit and inserted GCaMP3 downstream of the 3.2 Kb of the TαCP.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: