Your English writing platform
Discover LudwigExact(9)
This facility aims at both basic science and application goals, and is based on the double driver system, namely reactor driving and intense deuteron-beam driving.
Neural expression of UAS transgenes was achieved using the Appl-GAL4 driver or an elav-GAL4 Appl-GAL4 double driver chromosome in the case of experiments for rescue of the dp32 EC1 mutant behavioral phenotype.
This will open the Double Driver program.
A utility called Double Driver will do this for you.
Start off by downloading and installing the program Double Driver found here: Double Driver and select the Download Mirror.
Open up the Double Driver software and navigate to the "Restore" menu.
Similar(51)
He also became the youngest double Drivers' Champion in Formula One history.
Doubling drivers' fares tripled the number of cars on the road and kept them out there far longer.
Double strand driver cDNA was synthesised using driver3 primer which is phosphorylated and driver5 primer (TCCTAAGGTAGCGAGGCCATTACGGCCGGG) which is complementary to the 5' driver adaptor.
"Will we get there in time for the daily double?" The driver said, "Sure.
The falloff in taxi sales owes much to drivers like Mr. Fraser, who said he would hold onto his four-year-old cab longer than usual, rather than spend $42,000, roughly double a driver's annual salary, for a new one.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com