Your English writing platform
Discover LudwigExact(2)
But many rocks, stones and pebbles, like the ones that keep floating up from the soil when you are double digging.
His insistence on double digging — excavating the soil down two spade heights (about two feet), mixing it with organic conditioners and then mounding it in un-edged beds — makes for a backbreaking project.
Similar(58)
It comprised raised beds that were double dug and boosted by compost.
The project, run by charity Send a Cow and funded by DfID's Development Awareness Fund, gets farmers from the UK and Africa building African gardens in British farms and demonstrating approaches and techniques such as key-hole gardens, bag gardens, double dug beds, natural pesticides and plant teas.
Double DIG-labeled locked nucleic acid (LNA) hybridization probes complementary to mouse mature miR-18a (5DIGN/CTATCTGCACTAGATGCACCTTA/3DIG_N) (#38462-15), miR-19b (5DIGN/TCandTTTGCaTGGATTTGCACA/3DIG_N) (#38092-15), and a scrambled probe (5DIGN/GTGTAACACGTCTATACGCCCA/3DIG_N) (#99004-15) were purchased from Exiqon (Vedbaek, Denmark).
We performed nonradioactive ISH on paraffin tissue sections with a double DIG-labeled probe according to the manufacturer's instructions (Exiqon, Copenhagen, Denmark).
Whole-mount in situ hybridization using double DIG-labeled LNA oligos (Exiqon) or antisense RNA probes was carried out as previously described (Goljanek-Whysall et al., 2011).
Slides were then pre-hybridised at 50 °C in a hybridisation oven for 30 min followed by hybridisation with 200 n M double DIG-labelled LNA-modified probes for an hour at 50 °C.
To determine the histological expression pattern of miR-205 in prostatic tissues, we performed in situ hybridisation on prostatic tissues from 10 patients using double DIG-labeled LNA antisense-miR-205.
The qISH method was applied to three independent primary breast cancer cohorts (Cohort 1 with 461, Cohort 2 with 279 and Cohort 3 with 795 patients) using 5′ and 3′ double DIG-labelled LNA-modified probe against miR34a using the protocol described previously.
How to Double Dig a Garden.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com