Sentence examples for does not target from inspiring English sources

The control (nonsilencing) siRNA does not target any known mammalian gene (the targeted sequence is AATTCTCCGAACGTGTCACGT).

This investigation is open-ended and does not target anyone.

The U.S. military does not target civilians or civilian structures.

"This coalition does not target journalists," said Brig.

The draft bill does not target the directors.

Walker, however, claims the legislation does not "target the LGBTQ community" but "targets impostors," he said.

Al-Qaida distanced itself from Friday's bombings, insisting it does not target mosques.

To the best of D.O.D.'s knowledge, the investigation does not target any other D.O.D. individuals".

Importantly, our Brandeis tax does not target excessive income per se; it only caps inequality.

The NSA says it does not target Americans and its capabilities are deployed only against "valid foreign intelligence targets".

An individual's interest in making sure that the government does not target him erroneously could not be more significant.