Your English writing platform
Discover LudwigExact(2)
With the exception of Perry et al. 's [5] study on capuchin monkeys (Cebus capucinus), documenting variation in behaviors involving extractive foraging and tool-use has been a main focus of previous cross-site primate studies [3], [6], [32] [34].
Although suggestive, the absence of a sufficient number of studies documenting variation in energy gain among group members or the occurrence of agonism during feeding versus other behavioral contexts makes it difficult to draw firm conclusions regarding the potential relationship between diet, agonism, and within-group contest competition.
Similar(58)
Increasing emphasis has been placed on the collection of data documenting variations or disparities in health outcomes, with a view to minimizing these disparities as part of public health improvement [1].
Previous studies have documented variation across physicians in colonoscopy quality as measured by the adenoma detection rate (ADR).
In addition to detecting significant differences among varieties for pasta, sourdough, and pastry quality, participants documented variation in texture and flavor for the evaluated products.
We analyzed statewide, summary-level administrative data to document variation in the use of observation visits and observation charges relative to inpatient hospitalizations across six common emergency medical conditions.
Thanks to the rise of molecular biology and, more recently, of genomics, it also has been possible to document variation at the level of proteins, genes, and even individual DNA nucleotides in humans and many other species.
The impact of temperature and gas composition on respiration rates of postharvest produce is well understood, but only a few studies have documented variation in respiration rates of different varieties and at different harvest times of the growing season.
Moreover, it has been difficult to link documented variation in Middle Paleolithic artifact diversity or complexity to environmental factors [9], [10] or even hominin species.
While previous studies have documented variation in migration direction through the Strait of Georgia among species or populations [2], [3], we found intra-population variation among individuals, in three different species.
The following reverse primers were used to amplify transgenic 5' splice variants from YAC cDNA: HuMJD.Cter1.R 724 (5' gtgtcatatcttgagatatg 3') and HuMJD.Cter2.R 723 (5' ttctgaagtaagatttgtac 3') target exon 9 of human ataxin-3 to amplify 5' variants independently of the documented 3' variation.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com