Sentence examples for dna which also from inspiring English sources
CART-20 cells in PB could persist for at least 4 weeks in most patients with a higher CAR gene copy number (1000/μg DNA), which also could be detected in biopsy tissues derived from three of six evaluable patients even after 10 weeks of cell infusion.
The methylcytosine-specific enzyme McrBC exhibits a very similar restriction pattern for Medauroidea DNA, which also supports regional clustering of methylated and unmethylated DNA.
The genomic region corresponding with the NP225-GAL4 includingncluding the mdg3 natural transposon (see Figure 2B), was PCR amplified from NP80-GAL4 genomic DNA (which also contains the mdg3 element in this location) using NP225regionFOR-CACC CACCTGATAGTTTTTCAAAGATTCGACTTCGCTG) aNP225regionFOR-CACC CACCTGATAGTTTTTCAAAGATTCGACTTCGCTGs.
The data also indicated that large numbers of loci methylated in bovine embryos are also methylated in sperm DNA, which also corroborates a previous report [ 62].
In addition, it is thought that concatamers are more likely to occur with the random integration of plasmid DNA which also can potentially silence the transgene [ 93, 94].
We did not observe any centromeric hybridisation signals on the W chromosomes, suggesting repetitive sequences were successfully suppressed by c0t-1 DNA, which also confirm the cDNA clone mapping, i.e. rspo1 is autosomal.
Figure 2c shows the "ladder-shape" DNA fragmentation which also indicates DNA apoptosis [32].
Doxorubicin also induces cell-cycle arrest at the G2/M checkpoint [ 3] and induces apoptosis, probably by directly intercalating into double-stranded DNA [ 4], or by forming drug-DNA adducts, which also prevents DNA replication [ 5].
Many phages encode conservative site-specific recombination systems such as integrases and DNA-invertases, which also mediate DNA rearrangements.
DNA methylation is mediated (i.e., catalyzed) by three main enzymes called DNA methyltransferases (DNMTs), all of which transfer a methyl group from SAMe to DNA: DNMT1, which also is referred to as the maintenance DNMT, completes the methylation of the partially methylated (i.e., hemimethylated) DNA that is present in the cell after cell division and the accompanying DNA replication.
Judge Dredd 3D, to be directed by Pete Travis and produced by the UK's DNA Films, which also made Never Let Me Go, has racked up £20m of worldwide sales before shooting has even started.
