Sentence examples for dna solution to from inspiring English sources

The second step consists of the dispensing of another 50 nl of a 7.2 ng/μl sample DNA solution to the nanowells containing the primer mastermix combination.

The solution was slowly added to the DNA solution to ensure proper formation of DNA/PEI-complexes DNA/PEI-complexest roomixedperandre for 20 min.

To ensure complete denaturation of the DNA, 5 MM NaOH was added to the DNA solution to reach the final concentration of 0.4  M NaOH.

Use 4 μl of the DNA solution to confirm methylation by digestion with the appropriate methylation sensitive enzyme and agarose gel electrophoresis.

These experiments show that low-volume jet injection specifically targeted delivery of a DNA solution to the skin and that the injection paths did not reach into the underlying tissue.

We carried out injection into pronucleus and cytoplasm by holding the injection needle for a second in cytoplasm after injecting into pronuclei; this way we deliberately permitted a certain amount of DNA solution to flow into the cytoplasm.

PBAE 447e, stored in small aliquots at room temperature, 4 °C, or −20 °C, was dissolved in 25 mM NaAc and added to the DNA solution at 30 w/w for final DNA concentration of 15 μg/mL. of reconstituted lyophilized or fresh nanoparticles (100 μL) were then added dropwise to 500 μL of complete astrocyte medium in each well (1.5 μg DNA/well).

Fertilized eggs in 100 µl culture solution were mixed with 200 µl of 0.96 M mannitol and 50 µl of 0.25 0.5 µg/µl plasmid DNA solution, transferred to a cuvette with a 4 mm electrode gap and electroporated using the pulse generator ECM 830 (BTX, CA), according to a square pulse protocol (50 V and 16 ms per pulse).

Low-volume jet injection targeted delivery of a DNA solution exclusively to the dermis and epidermis of rabbits.

The samples for uptake were prepared with 5 μL of the labeled DNA solution added to 2, 6 or 18 μg of the polymer (0.3, 1 and 3 μg for branched PEI) in a final volume of 40 μL.

All qPCR assays were run in triplicate with a total reaction volume of 20 μl comprising of 1× Power SYBR Green PCR Master Mix Lifee Technologies, USA), 200 nM of both the forward (CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT) and reverse (TTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT) primers (Integrated DNA technologies, IA, USA), and 2 μl of target DNA solution adjusted to the total reaction volume.