Exact(7)
Sara insisted on focusing PTA efforts on community building and organizing diverse parent engagement so that the school leadership included voices of the immigrant and non-immigrant Latino/a, Black, and Asian families that made up the community.
Results in the Japanese population were consistent with the more ethnically diverse parent study.
Results in this population were consistent with those seen in the more ethnically diverse parent study.
The field pea trial grown in 2010, cycle 1, included 959 segregating S0 individuals representing 115 crosses among 76 diverse parent genotypes.
To test for the occurrence of the CD-5 candidate SNP in the soybean germplasm, the portion of the third exon of Glyma15g08680 containing the SNP was also PCR amplified from these 29 diverse parent lines using primers 5′GGCTAGGCCTTTGTGTTTGA 3′ and 5′AACGGGAAATGCTGATTGAG 3′.
To test for the occurrence of the y11 and MinnGold candidate SNPs in a diverse set of the soybean germplasm, the portion of the third exon of Glyma13g30560 containing the candidate SNPs was PCR amplified from 29 diverse parent lines (McHale et al. 2012) using primers 5′GGCCAGGCCTTTGCATTTTG 3′ and 5′ACTCAGCACACACCTTGGAG 3′.
Similar(53)
In particular, the relatively straightforward construction of Recombinant Inbred Line RILL) populations – that is populations that are composed of the close to homozygous progeny of phenotypically diverse parents [ 29] – facilitates the exploration of intra-population diversity.
One of the skills, working with diverse parents, begs for attention.
This paper displays a panorama of diverse parenting education models used internationally.
For this purpose, half-diallel crosses among seven diverse parents were made.
The survey will be administered at two time points to diverse parents (n = 1200) of children ages 5 9.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com