The PCRs using the primers Palu-F/Palu-R and 621/983 yielded distinct amplification products of the expected sizes from various DNA extracts of the lung, brain, liver and spleen of the 13 ISH-positive penguins and confirmed the tentative diagnosis of an infection with avian malaria parasites.
Only sharp, distinct amplification products with a total yield of >200 ng were used for 454 sequencing.
As a proof of principle, we analysed neuroblastoma cell line IMR-32 which contains at least two distinct amplification sites on the short arm of chromosome 2 [ 10, 11].
Amplification with forward primers P18 (5'-GAGGAAAAATCTCTCACATCTCCACACG-3') and P19 (5'- TCAAGTTCACCTCCAACTAAAGGGAAGG–3') resulted in the amplification of distinct PCR-products of approximately 6.5 kb and 1.5 kb, respectively.
After PCR, gel electrophoresis was done along with 1 kb DNA ladder to check the amplification of distinct PCR products.
Our study combined the use of fecal samples along with 3 distinct strategies for molecular amplification of isolates, thus improving previous strategies used in onychomadesis outbreaks.
Another study found amplification of distinct loci restricted to a specific population of cancer cells in 3 out of 13 matched DCIS − IDC pairs [ 8].
In all, 12 carcinomas presented with distinct KIT overexpression and amplification of KIT gene was considered as a possible mechanism for overexpression.
Three of the loci were monomorphic, five yielded poor sequence quality, which was associated with either failure of the sequence reaction or ambiguous base calls that were likely due to heterozygosity of the parents that resulted in amplification of distinct alleles of a given locus.
The implementation of these methods on ovarian tumors, which contain a large number of amplifications, allows for the examination of the general pattern of amplification in ovarian tumors and suggests that there might be two distinct patterns of amplification present: steady accumulation of amplifications over time versus whole-genome amplification.
