Sentence examples for disruption sequence from inspiring English sources

The viral strain now in Brazil, he says, is "clearly new, different, and vastly more dangerous," with what appears to be a "truly causal" relationship to microcephaly — in Brazil, Attaran writes, the effects of microcephaly have been "suggestive of 'fetal brain disruption sequence' in which the developing brain and skull collapse while other anatomical features like the scalp skin keep growing".

There are established methods for predicting mutation severity based on amino acid substitution penalties, structural disruption, sequence homology (ortholog conservation) or neural nets, such as PolyPhen [13], SIFT [14], MutPred [9] and PMut [15].

Established prediction algorithms were chosen with various and complementary methodologies, such as amino acid substitution penalties, structural disruption, sequence homology (ortholog conservation) and neural nets.

These seven cases are summarized in Table 2. * Final diagnosis: trisomy 21 ** Final diagnosis: amnion disruption sequence *** Final diagnosis: VACTERL-H syndrome Since Seppala and Unnerus [ 1] first suggested a possible association between elevated AFP levels and fetal hydrocephalus, there has been a relative lack of information about the subject in the literature.

The poly(A) disruption primer sequence was attctagaggccgaggcggccgacatgt(4 gtct(4)gttctgt(3)ct(4)VN, where numbers in parentheses indicate the number of times the preceding base appeared in the sequence and V was a, g, or c.

Zambrowicz, B.P. et al. Disruption and sequence identification of 2,000 genes in mouse embryonic stem cells.

Kriventseva et al [ 63] find that disruption of sequence forming a domain (similar to domain truncations) is seen in considerable fraction (up to 28%) of splice variants.

In this respect, the generally hypomethylated epigenetic state of the placenta might make retrotransposons in this tissue particularly sensitive to any additional epigenetic disruption or sequence variation that would remove another layer of suppression from these elements.

To analyze gene disruption by sequencing, we PCR-amplified and cloned target fragments allowing for separate sequencing of plasmid preparations from separate bacterial clones.

Efficient homologous gene targeting in DT40 makes gene disruptions and sequence manipulations feasible; therefore, the cell line is uniquely suited to genetic studies (Buerstedde and Takeda 1991).

To answer this question, we analysed the distribution of initial frame disruptions in sequences relative to the placement of protein structure domains from the SCOP data (see Methods for details).